|
Proteintech
anti slirp Anti Slirp, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti slirp/product/Proteintech Average 93 stars, based on 1 article reviews
anti slirp - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Microsynth ag
stem-loop rna/dna oligonucleotide bearing a cy3 fluorescent dye Stem Loop Rna/Dna Oligonucleotide Bearing A Cy3 Fluorescent Dye, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop rna/dna oligonucleotide bearing a cy3 fluorescent dye/product/Microsynth ag Average 90 stars, based on 1 article reviews
stem-loop rna/dna oligonucleotide bearing a cy3 fluorescent dye - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Molecular Dynamics Inc
divalent ion dependent conformational changes in an rna stem-loop Divalent Ion Dependent Conformational Changes In An Rna Stem Loop, supplied by Molecular Dynamics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/divalent ion dependent conformational changes in an rna stem-loop/product/Molecular Dynamics Inc Average 90 stars, based on 1 article reviews
divalent ion dependent conformational changes in an rna stem-loop - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Keio University Press Inc
stem–loop rna oligonucleotide Stem–Loop Rna Oligonucleotide, supplied by Keio University Press Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem–loop rna oligonucleotide/product/Keio University Press Inc Average 90 stars, based on 1 article reviews
stem–loop rna oligonucleotide - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ST Pharm Co
stem-loop rna Stem Loop Rna, supplied by ST Pharm Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop rna/product/ST Pharm Co Average 90 stars, based on 1 article reviews
stem-loop rna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Oligos Etc
synthetic rna comprised of various stem loop regions of the human u1 snrna ![]() Synthetic Rna Comprised Of Various Stem Loop Regions Of The Human U1 Snrna, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic rna comprised of various stem loop regions of the human u1 snrna/product/Oligos Etc Average 90 stars, based on 1 article reviews
synthetic rna comprised of various stem loop regions of the human u1 snrna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Metabion International AG
stem loop rna from the son transcript gene (ggaucuuuaacuacucaagauacugaacaugacauggua) with cy5-label ![]() Stem Loop Rna From The Son Transcript Gene (Ggaucuuuaacuacucaagauacugaacaugacauggua) With Cy5 Label, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem loop rna from the son transcript gene (ggaucuuuaacuacucaagauacugaacaugacauggua) with cy5-label/product/Metabion International AG Average 90 stars, based on 1 article reviews
stem loop rna from the son transcript gene (ggaucuuuaacuacucaagauacugaacaugacauggua) with cy5-label - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Axolabs Inc
synthetic stem loop rna agcacggcuguaaaccgugc ![]() Synthetic Stem Loop Rna Agcacggcuguaaaccgugc, supplied by Axolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic stem loop rna agcacggcuguaaaccgugc/product/Axolabs Inc Average 90 stars, based on 1 article reviews
synthetic stem loop rna agcacggcuguaaaccgugc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Moderna
stem-loop d of the cloverleaf domain of enteroviral 50utr rna ![]() Stem Loop D Of The Cloverleaf Domain Of Enteroviral 50utr Rna, supplied by Moderna, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop d of the cloverleaf domain of enteroviral 50utr rna/product/Moderna Average 90 stars, based on 1 article reviews
stem-loop d of the cloverleaf domain of enteroviral 50utr rna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Azenta
anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa ![]() Anticodon Stem Loop Rna (32 Nucleotides, /5 Fam/Uuggacuucuagugacgaauagagcaauucaa, supplied by Azenta, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa/product/Azenta Average 90 stars, based on 1 article reviews
anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Ocimum Biosolutions
32 nucleotide long stem loop sequence of rre-iib rna ![]() 32 Nucleotide Long Stem Loop Sequence Of Rre Iib Rna, supplied by Ocimum Biosolutions, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/32 nucleotide long stem loop sequence of rre-iib rna/product/Ocimum Biosolutions Average 90 stars, based on 1 article reviews
32 nucleotide long stem loop sequence of rre-iib rna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Blackwell Science Ltd
fusion construct of stem±loop i of lbi rna and a hammerhead ribozyme ![]() Fusion Construct Of Stem±Loop I Of Lbi Rna And A Hammerhead Ribozyme, supplied by Blackwell Science Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fusion construct of stem±loop i of lbi rna and a hammerhead ribozyme/product/Blackwell Science Ltd Average 90 stars, based on 1 article reviews
fusion construct of stem±loop i of lbi rna and a hammerhead ribozyme - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Oncotarget
Article Title: Cancer therapies activate RIG-I-like receptor pathway through endogenous non-coding RNAs
doi: 10.18632/oncotarget.8420
Figure Lengend Snippet: A. RIG-I binds diverse non-coding RNA molecules, majority of which are snRNAs. Graphic representation indicating the distribution of non-coding and repetitive RNA molecules bound to RIG-I following exposure to IR as compared to total irradiated cellular RNA. Transcripts were mapped to reference genomes using RepeatMasker. See Methods for further details. B. qRT-PCR quantification of U1 RNA from purified RNA bound to ectopically expressing WT and K858A-K861A mutant RIG-I HEK293 cells exposed to IR (6 Gy) or left untreated. Cells were UV crosslinked at 150mJ/cm 2 48 hours post-IR treatment prior to cell lysis. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. C. U1 RNA levels quantified by qRT-PCR from total cellular and RIG-I pulldowns in RIG-I overexpressing HEK293 and HCT116 cells. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. Time course of cytosolic accumulation of U1 RNA measured by qRT-PCR from purified total cellular RNA following cellular fractionation of nuclear/mitochondrial and cytoplasmic fractions of HEK293 D. and HCT116 cells E. exposed to IR (6 Gy) or left untreated. F. The structure of the U1 snRNA illustrating the four stem loop (SL) regions. G. Relative IFN-beta luciferase reporter activity of HEK293 cells following a 24 hour stimulation with synthetic oligonucleotides corresponding to U1 RNA stem loop (SL) regions I to IV or a combination of SL I + II and SL II + III. H. IFN-b levels in culture supernatant from ICR RIG-I +/+ and RIG-I −/− primary MEFs 24 hours post-stimulation with the same set of synthetic U1 oligonucleotides used in G. The amount of U1 synthetic oligonucleotides used in all stimulation experiments was 1μg. P values were determined using unpaired Student's t -test. Error bars are SEM. *** P < 0.005.
Article Snippet:
Techniques: Irradiation, Quantitative RT-PCR, Purification, Expressing, Mutagenesis, Lysis, Cell Fractionation, Luciferase, Activity Assay
Journal: Life Science Alliance
Article Title: Multi-omics profiling identifies a deregulated FUS-MAP1B axis in ALS/FTD–associated UBQLN2 mutants
doi: 10.26508/lsa.202101327
Figure Lengend Snippet: (A) Schematic representation of FUS. SYGQ-rich, serine, tyrosine, glycine, glutamine-rich domain; RRM, RNA recognition motif; RGG, arginine-glycine-glycine–rich region; NLS, nuclear localization signal; ZnF, zinc finger domain. (B) Immunoblot analysis of the Phos-tag gel– (upper panel) and SDS–PAGE (lower panel)–separated lysates derived from UBQLN2 WT and amyotrophic lateral sclerosis–mutant LCLs. (C) Immunoblot of UBQLN2 KO HeLa cells treated with two different siRNAs targeting FUS or a nontargeting siRNA control (siCtrl). (C, D) Quantification of MAP1B and FUS protein levels from (C). Data represent mean ± SD. Statistical analysis (n = 3) of the target protein/control protein ratio was performed using one-way ANOVA followed by Dunnett’s post hoc test. (E) SDS–PAGE of recombinant FUS variants (WT, S439A, S439E) stained with Coomassie blue. (F) Electrophoretic mobility shift assay (EMSA) of MBP-FUS-His 6 variants (WT, S439A, S439E) and SON pre-mRNA containing the stem loop and a downstream GUU (5 nM) (n = 3). (G) Immunoblot of FUS WT and KO HeLa cells. (H) FUS WT and KO cells transfected with HA-FUS proteoforms (WT and S439A) or left untreated (MOCK; only Lipofectamine). (I) Quantification of MAP1B protein levels upon expression of HA-FUS WT and S439A from (I). Data represent mean ± SD. Statistical analysis (n = 3) of the target protein/control protein ratio was performed using t test. (J) Working model: in cells with UBQLN2 WT, FUS S439 is constitutively phosphorylated, a state where FUS-RNA binding is impaired. UBQLN2 mutations (P497S and T497I) result in a reduction of pS439 and in elevated MAP1B levels, which are also observed upon UBQLN2 KO. Depending on whether UBQLN2 is functional or defective, KO of FUS has opposing effects on MAP1B levels.
Article Snippet: The
Techniques: Western Blot, SDS Page, Derivative Assay, Mutagenesis, Control, Recombinant, Staining, Electrophoretic Mobility Shift Assay, Transfection, Expressing, RNA Binding Assay, Functional Assay